Skip to main content
Addgene

pAAV-pMecp2-SaCas9-pU6-sgRNA
(Plasmid #159173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159173 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX601 (Addgene #61591)
  • Total vector size (bp) 6889
  • Modifications to backbone
    replaced CMV promoter with pMecp2; replace bGHpA with spA
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SaCas9
  • Species
    Synthetic
  • Insert Size (bp)
    3260
  • Promoter pMecp2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BamH (unknown if destroyed)
  • 5′ sequencing primer GCAGGTTGTAGTCGAACAGCAGCT
  • 3′ sequencing primer CAGCACAGACATTCTGGGCAACCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pMecp2-SaCas9-pU6-sgRNA was a gift from Chung Tin (Addgene plasmid # 159173 ; http://n2t.net/addgene:159173 ; RRID:Addgene_159173)
  • For your References section:

    Targeted Transgene Activation in the Brain Tissue by Systemic Delivery of Engineered AAV1 Expressing CRISPRa. Lau CH, Ho JW, Lo PK, Tin C. Mol Ther Nucleic Acids. 2019 Jun 7;16:637-649. doi: 10.1016/j.omtn.2019.04.015. Epub 2019 Apr 23. 10.1016/j.omtn.2019.04.015 PubMed 31108320