-
PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven tdTomato cassette (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Vector typeMammalian Expression, AAV ; S1 knockin donor vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
Insert Size (bp)1431
- Promoter CAGGS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer ggcggctctagagcctctgctaacc
- 3′ sequencing primer ttggcagagggaaaaagatctcagtgg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-tdTomato was a gift from Rudolf Jaenisch (Addgene plasmid # 159275 ; http://n2t.net/addgene:159275 ; RRID:Addgene_159275) -
For your References section:
Establishment of human pluripotent stem cell-derived pancreatic beta-like cells in the mouse pancreas. Ma H, Wert KJ, Shvartsman D, Melton DA, Jaenisch R. Proc Natl Acad Sci U S A. 2018 Apr 10;115(15):3924-3929. doi: 10.1073/pnas.1702059115. Epub 2018 Mar 29. 10.1073/pnas.1702059115 PubMed 29599125