pET11a-DAAT-V33G/T242G
(Plasmid
#159278)
-
PurposeAminotransferase variant with near-native catalytic efficiency toward D-tryptophan
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-11a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5677
- Total vector size (bp) 6517
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEngineered d-alanine aminotransferase
-
Alt nameDAAT-V33G/T242G
-
SpeciesBacillus sp.
-
Insert Size (bp)876
-
MutationValine 33 and threonine 242 have been mutated to glycine
-
GenBank IDJ04460.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 Terminal GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a-DAAT-V33G/T242G was a gift from Roberto Chica (Addgene plasmid # 159278 ; http://n2t.net/addgene:159278 ; RRID:Addgene_159278) -
For your References section:
One-Pot Biocatalytic Synthesis of Substituted D-Tryptophans from Indoles Enabled by an Engineered Aminotransferase. Parmeggiani F, Rué Casamajo A, Walton CJW, Galman JL, Turner NJ, Chica RA. ACS Catalysis 9, 3482–3486. 10.1021/acscatal.9b00739