INS-2A-luciferase-2A-CD19-GFP
(Plasmid
#159349)
-
PurposeHuman INS targeting vector for knockin of 2A separated luciferase, humand CD19, and GFP. Targeted cells will be puromycin resistant.
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 159349-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 159349-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePL253
-
Vector typeINS locus knockin donor vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable ; Stbl 3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLuciferase-2A-human_CD19-2A-GFP
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggagaactactgcaacggtacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLuciferase-2A-human_CD19-2A-GFP
-
Alt nameCD19
-
SpeciesH. sapiens (human)
-
Entrez GeneCD19 (a.k.a. B4, CVID3)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 159349-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 159349-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
INS-2A-luciferase-2A-CD19-GFP was a gift from Rudolf Jaenisch (Addgene plasmid # 159349 ; http://n2t.net/addgene:159349 ; RRID:Addgene_159349) -
For your References section:
Human T Cells Expressing a CD19 CAR-T Receptor Provide Insights into Mechanisms of Human CD19-Positive beta Cell Destruction. Ma H, Jeppesen JF, Jaenisch R. Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22. 10.1016/j.xcrm.2020.100097 PubMed 33205073
