human TLNRD1 pET151
(Plasmid
#159384)
-
PurposeExpresses human TLNRD1 in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET151
- Backbone size w/o insert (bp) 5760
- Total vector size (bp) 6846
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTalin Rod Domain Containing Protein 1
-
Alt nameTLNRD1
-
Alt nameMESDC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1086
-
Entrez GeneTLNRD1 (a.k.a. MESDC1)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag, TEV cleavage site (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human TLNRD1 pET151 was a gift from Ben Goult (Addgene plasmid # 159384 ; http://n2t.net/addgene:159384 ; RRID:Addgene_159384) -
For your References section:
Talin rod domain-containing protein 1 (TLNRD1) is a novel actin-bundling protein which promotes filopodia formation. Cowell AR, Jacquemet G, Singh AK, Varela L, Nylund AS, Ammon YC, Brown DG, Akhmanova A, Ivaska J, Goult BT. J Cell Biol. 2021 Sep 6;220(9). pii: 212472. doi: 10.1083/jcb.202005214. Epub 2021 Jul 15. 10.1083/jcb.202005214 PubMed 34264272