Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

human TLNRD1-4H pET151
(Plasmid #159386)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159386 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5760
  • Total vector size (bp) 6153
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin Rod Domain Containing Protein 1
  • Alt name
    TLNRD1-4H
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    393
  • Mutation
    TLNRD1 4-helix domain (residues 143-273)
  • Entrez Gene
    TLNRD1 (a.k.a. MESDC1)
  • Promoter T7
  • Tag / Fusion Protein
    • his-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human TLNRD1-4H pET151 was a gift from Ben Goult (Addgene plasmid # 159386 ; http://n2t.net/addgene:159386 ; RRID:Addgene_159386)
  • For your References section:

    Talin rod domain-containing protein 1 (TLNRD1) is a novel actin-bundling protein which promotes filopodia formation. Cowell AR, Jacquemet G, Singh AK, Varela L, Nylund AS, Ammon YC, Brown DG, Akhmanova A, Ivaska J, Goult BT. J Cell Biol. 2021 Sep 6;220(9). pii: 212472. doi: 10.1083/jcb.202005214. Epub 2021 Jul 15. 10.1083/jcb.202005214 PubMed 34264272