pL0-NbBCP1bPro
              
              
                (Plasmid
                
                #159417)
              
            
            
            
          - 
            PurposeNicotiana benthamiana BCP1b promoter sequence (1231 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepICH41295
- 
              Backbone manufacturer47997 (Sylvestre Marillonnet)
- Backbone size w/o insert (bp) 2251
- Total vector size (bp) 3482
- 
              Vector typeBacterial Expression ; pUC19-derived
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameNbBCP1b Pro
- 
                  Alt nameBlue Copper Protein 1b Promoter
- 
                    SpeciesNicotiana benthamiana
- 
                  Insert Size (bp)1231
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer MoClo_lv0_F0015: CGTTATCCCCTGATTCTGTGGATAAC
- 3′ sequencing primer MoClo_lv0_R0016: GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pL0-NbBCP1bPro was a gift from Sam Brockington (Addgene plasmid # 159417 ; http://n2t.net/addgene:159417 ; RRID:Addgene_159417)
- 
                For your References section: MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583
 
    
 
                         
             
            