Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PX458-Lck
(Plasmid #159430)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 9271
  • Total vector size (bp) 9291
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting Lck exon 2
  • gRNA/shRNA sequence
    GACCCACTGGTTACCTACGA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001042771.2
  • Entrez Gene
    LCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    PX458 backbone vector from Addgene #48138 (Feng Zhang Lab)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-Lck was a gift from Arthur Salomon (Addgene plasmid # 159430 ; http://n2t.net/addgene:159430 ; RRID:Addgene_159430)
  • For your References section:

    Quantitative Interactomics of Lck-TurboID in Living Human T Cells Unveils T Cell Receptor Stimulation-Induced Proximal Lck Interactors. Chua XY, Aballo T, Elnemer W, Tran M, Salomon A. J Proteome Res. 2020 Nov 13. doi: 10.1021/acs.jproteome.0c00616. 10.1021/acs.jproteome.0c00616 PubMed 33185455