Skip to main content

pcDNA3-P1-N-miRFP670-C-LoxP-Neo
(Plasmid #159435)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159435 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Total vector size (bp) 7994
  • Vector type
    CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    miRFP670
  • Insert Size (bp)
    945
  • Tags / Fusion Proteins
    • 5' linker pair 1 (N terminal on backbone)
    • N terminal peptide linker (N terminal on insert)
    • C terminal peptide linker (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site n/a (unknown if destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Neomycin
  • Insert Size (bp)
    1490
  • Promoter SV40
  • Tags / Fusion Proteins
    • LoxP (N terminal on insert)
    • LoxP (C terminal on insert)
    • 3' linker pair 1 (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site n/a (unknown if destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer GAAAGGACAGTGGGAGTGGCACCTTCCAGGGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-P1-N-miRFP670-C-LoxP-Neo was a gift from Jianhua Xing (Addgene plasmid # 159435)
  • For your References section:

    Rapid, modular, and cost-effective generation of donor DNA constructs for CRISPR-based gene knock-in. Chen YJ, Cheng YY, Wang W, Tian XJ, Lefever DE, Taft DA, Zhang J, Xing J. Biol Methods Protoc. 2020 Mar 20;5(1):bpaa006. doi: 10.1093/biomethods/bpaa006. eCollection 2020. 10.1093/biomethods/bpaa006 PubMed 32411820