pcDNA3-P1-N-miRFP670-C
(Plasmid
#159438)
-
PurposeCRISPR knock-in donor construct with fluorescent reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Total vector size (bp) 6432
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRFP670
-
Insert Size (bp)945
- Promoter CMV
-
Tags
/ Fusion Proteins
- 5' linker pair 1 (N terminal on backbone)
- N terminal peptide linker (N terminal on insert)
- C terminal peptide linker (C terminal on insert)
- 3' linker pair 1 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer GAAAGGACAGTGGGAGTGGCACCTTCCAGGGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-P1-N-miRFP670-C was a gift from Jianhua Xing (Addgene plasmid # 159438 ; http://n2t.net/addgene:159438 ; RRID:Addgene_159438) -
For your References section:
Rapid, modular, and cost-effective generation of donor DNA constructs for CRISPR-based gene knock-in. Chen YJ, Cheng YY, Wang W, Tian XJ, Lefever DE, Taft DA, Zhang J, Xing J. Biol Methods Protoc. 2020 Mar 20;5(1):bpaa006. doi: 10.1093/biomethods/bpaa006. eCollection 2020. 10.1093/biomethods/bpaa006 PubMed 32411820