pCL33-decoder
(Plasmid
#159451)
-
PurposeInsert: Pfus1mut-tetR-nls-malE-tCyc1. TetR-NLS-MBP (Azizoglu et al, bioRxiv 2019) is inducible by alpha-factor. Backbone: pRG203MX (addgene). Marker: His3.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRG203MX
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 3749
- Total vector size (bp) 6684
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePfus1mut-tetR-nls-malE-tCyc1
-
SpeciesSynthetic
-
Insert Size (bp)2935
- Promoter Pfus1mut
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AATTAACCCTCACTAAAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPart of the insert (tetr-nls-malE) from Azizoğlu, A., Brent, R. & Rudolf, F. A precisely-titratable, variation-suppressed transcriptional controller to enable genetic discovery. bioRxiv, doi:10.1101/2019.12.12.874461 (2019).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCL33-decoder was a gift from Joerg Stelling (Addgene plasmid # 159451 ; http://n2t.net/addgene:159451 ; RRID:Addgene_159451) -
For your References section:
A rationally engineered decoder of transient intracellular signals. Lormeau C, Rudolf F, Stelling J. Nat Commun. 2021 Mar 25;12(1):1886. doi: 10.1038/s41467-021-22190-4. 10.1038/s41467-021-22190-4 PubMed 33767179