pQdCas9-sgempty
(Plasmid
#159523)
-
PurposeExpression of dCas9 driven by lux cassette from Vibrio fischeri
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBBRMCS2
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsthe plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namequorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dcas9 and sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)6000
- Promoter quorum sensing promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGGATCTCGTCGTGACCCATG
- 3′ sequencing primer AAACGGAGGAATGGGAACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQdCas9-sgempty was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 159523 ; http://n2t.net/addgene:159523 ; RRID:Addgene_159523) -
For your References section:
Dynamic Cell Programming with Quorum Sensing-Controlled CRISPRi Circuit. Liu Y, Chen J, Crisante D, Jaramillo Lopez JM, Mahadevan R. ACS Synth Biol. 2020 Jun 5. doi: 10.1021/acssynbio.0c00148. 10.1021/acssynbio.0c00148 PubMed 32485106