pZmSWEET13a:ZmSWEET13a:GUS
(Plasmid
#159535)
-
Purposeexpresses ß--glucuronidase in cells expressing ZmSWEET13a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGoldenGate-AG
- Backbone size w/o insert (bp) 8469
- Total vector size (bp) 19028
-
Modifications to backbonenone
-
Vector typeBacterial Expression, Plant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZmSWEET13a
-
Alt nameZmSWT13a
-
SpeciesZ. mays
-
Insert Size (bp)10556
-
GenBank IDNM_001155615
- Promoter native SWEET13a promoter
-
Tag
/ Fusion Protein
- GUS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACGACAGATCGATCAACCCAAT
- 3′ sequencing primer TCGTACCACTTCTCTTCCAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.09.06.284943 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZmSWEET13a:ZmSWEET13a:GUS was a gift from Wolf Frommer (Addgene plasmid # 159535 ; http://n2t.net/addgene:159535 ; RRID:Addgene_159535) -
For your References section:
Evidence for phloem loading via the abaxial bundle sheath cells in maize leaves. Bezrutczyk M, Zollner NR, Kruse CPS, Hartwig T, Lautwein T, Kohrer K, Frommer WB, Kim JY. Plant Cell. 2021 May 5;33(3):531-547. doi: 10.1093/plcell/koaa055. 10.1093/plcell/koaa055 PubMed 33955497