Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJo55-CA1
(Plasmid #159624)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159624 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJo55
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C. annuum eIF4E-1
  • Alt name
    pvr1
  • Species
    C. annuum
  • Insert Size (bp)
    687
  • GenBank ID
    NM_001324970

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gacggtaggtattgattgta
  • 3′ sequencing primer CCTAGACTTCAGGTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJo55-CA1 was a gift from Vasiliy Taranov (Addgene plasmid # 159624 ; http://n2t.net/addgene:159624 ; RRID:Addgene_159624)
  • For your References section:

    VPg of Potato Virus Y and Potato Cap-Binding eIF4E Factors: Selective Interaction and Its Supposed Mechanism. Lebedeva MV, Nikonova EY, Terentiev AA, Taranov VV, Babakov AV, Nikonov OS. Biochemistry (Mosc). 2021 Sep;86(9):1128-1138. doi: 10.1134/S000629792109008X. 10.1134/S000629792109008X PubMed 34565316