RKS-Fzd7 subtype NGS Wnt
(Plasmid
#159626)
-
PurposeExpress Fzd7 subtype NGS Wnt in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneRKS vector
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFzd7 subtype NGS Wnt
-
SpeciesSynthetic
-
Insert Size (bp)966
-
Tag
/ Fusion Protein
- His tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCGCGCTTCTGCTTCCCGAGC
- 3′ sequencing primer GCGGCTTCGGCCAGTAACG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RKS-Fzd7 subtype NGS Wnt was a gift from Chris Garcia (Addgene plasmid # 159626 ; http://n2t.net/addgene:159626 ; RRID:Addgene_159626) -
For your References section:
Next-Generation Surrogate Wnts Support Organoid Growth and Deconvolute Frizzled Pleiotropy In Vivo. Miao Y, Ha A, de Lau W, Yuki K, Santos AJM, You C, Geurts MH, Puschhof J, Pleguezuelos-Manzano C, Peng WC, Senlice R, Piani C, Buikema JW, Gbenedio OM, Vallon M, Yuan J, de Haan S, Hemrika W, Rosch K, Dang LT, Baker D, Ott M, Depeille P, Wu SM, Drost J, Nusse R, Roose JP, Piehler J, Boj SF, Janda CY, Clevers H, Kuo CJ, Garcia KC. Cell Stem Cell. 2020 Aug 14. pii: S1934-5909(20)30358-1. doi: 10.1016/j.stem.2020.07.020. 10.1016/j.stem.2020.07.020 PubMed 32818433