Skip to main content

pCSC-CMV-HA-Ast-3-NP-1-IRES-mCherry
(Plasmid #159631)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159631 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSC
  • Backbone size w/o insert (bp) 8472
  • Total vector size (bp) 10168
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ast
  • Alt name
    Allatostatin-3, Ast,
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1700
  • GenBank ID
    AE014297.3
  • Entrez Gene
    AstA (a.k.a. Dmel_CG13633, ALLS, AS, ASA, AST, AST-1, AST-3, AST-4, AST-A, Allatostatin A1, Allatostatin A2, Allatostatin A3, Allatostatin A4, Ast, Ast-A, AstA-1, AstA-2, AstA-3, AstA-4, AstA1, AstA2, AstA4, BcDNA:RE16553, CG13633, DAP, DAP-A, DST-1A, DST-2A, DST-3A, DST-4A, Dmel\CG13633, Drm-AST-1, Drm-AST-2, Drm-AST-3, Drm-AST-4, Drm-AST-A, ast)
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • neurophysin-1 (C terminal on insert)
    • IRES (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI or XbaI (not destroyed)
  • 5′ sequencing primer HA F: TACCCATACGACGTCCCAGA
  • 3′ sequencing primer mCherry R: TTGGTCACCTTCAGCTTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains K4M and G5D mutations in mCherry. These mutations do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSC-CMV-HA-Ast-3-NP-1-IRES-mCherry was a gift from Andrew Allen & Ross Bathgate (Addgene plasmid # 159631 ; http://n2t.net/addgene:159631 ; RRID:Addgene_159631)
  • For your References section:

    A Chemogenetic Tool that Enables Functional Neural Circuit Analysis. Ngo HB, Melo MR, Layfield S, Connelly AA, Bassi JK, Xie L, Menuet C, McDougall SJ, Bathgate RAD, Allen AM. Cell Rep. 2020 Sep 15;32(11):108139. doi: 10.1016/j.celrep.2020.108139. 10.1016/j.celrep.2020.108139 PubMed 32937120