pEGFP-CHAMP1
(Plasmid
#159892)
-
PurposeExpresses CHAMP1 (CAMP) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech (TaKaRa)
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 7164
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHAMP1
-
Alt nameCAMP (chromosome alignment-maintaining phosphoprotein), C13orf8, ZNF828
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2436
-
GenBank IDNM_032436 NM_001164144
-
Entrez GeneCHAMP1 (a.k.a. C13orf8, CAMP, CHAMP, MRD40, ZNF828)
- Promoter CMV
-
Tag
/ Fusion Protein
- pEGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC identified a partial deletion of the SV40 promoter compared to the hypothetical plasmid sequence. The depositing lab does not consider this to be of concern in regard to the function of this plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-CHAMP1 was a gift from Kozo Tanaka (Addgene plasmid # 159892 ; http://n2t.net/addgene:159892 ; RRID:Addgene_159892) -
For your References section:
CAMP (C13orf8, ZNF828) is a novel regulator of kinetochore-microtubule attachment. Itoh G, Kanno S, Uchida KS, Chiba S, Sugino S, Watanabe K, Mizuno K, Yasui A, Hirota T, Tanaka K. EMBO J. 2011 Jan 5;30(1):130-44. doi: 10.1038/emboj.2010.276. Epub 2010 Nov 9. 10.1038/emboj.2010.276 PubMed 21063390