pEGFP-NUP188
(Plasmid
#159893)
-
PurposeExpresses NUP188 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech (TaKaRa)
- Backbone size w/o insert (bp) 3965
- Total vector size (bp) 9204
-
Modifications to backboneKanamycin-resistant gene was replaced with ampicillin-resistant gene, and the multi-cloning site was also replaced.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNUP188
-
Alt nameNucleoporin 188
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5239
-
MutationTo avoid NotI site, first three amino acids are deleted, amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP (Please see depositor comments)
-
GenBank IDNM_015354.3
-
Entrez GeneNUP188 (a.k.a. KIAA0169, SANDSTEF, hNup188)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS had amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP, but depositor confirms that these discrepancies do not have any functional significance on the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-NUP188 was a gift from Kozo Tanaka (Addgene plasmid # 159893 ; http://n2t.net/addgene:159893 ; RRID:Addgene_159893) -
For your References section:
Nucleoporin Nup188 is required for chromosome alignment in mitosis. Itoh G, Sugino S, Ikeda M, Mizuguchi M, Kanno S, Amin MA, Iemura K, Yasui A, Hirota T, Tanaka K. Cancer Sci. 2013 Jul;104(7):871-9. doi: 10.1111/cas.12159. Epub 2013 May 2. 10.1111/cas.12159 PubMed 23551833