Skip to main content

pEGFP-NUP188
(Plasmid #159893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159893 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech (TaKaRa)
  • Backbone size w/o insert (bp) 3965
  • Total vector size (bp) 9204
  • Modifications to backbone
    Kanamycin-resistant gene was replaced with ampicillin-resistant gene, and the multi-cloning site was also replaced.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NUP188
  • Alt name
    Nucleoporin 188
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5239
  • Mutation
    To avoid NotI site, first three amino acids are deleted, amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP (Please see depositor comments)
  • GenBank ID
    NM_015354.3
  • Entrez Gene
    NUP188 (a.k.a. KIAA0169, SANDSTEF, hNup188)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS had amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP, but depositor confirms that these discrepancies do not have any functional significance on the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-NUP188 was a gift from Kozo Tanaka (Addgene plasmid # 159893 ; http://n2t.net/addgene:159893 ; RRID:Addgene_159893)
  • For your References section:

    Nucleoporin Nup188 is required for chromosome alignment in mitosis. Itoh G, Sugino S, Ikeda M, Mizuguchi M, Kanno S, Amin MA, Iemura K, Yasui A, Hirota T, Tanaka K. Cancer Sci. 2013 Jul;104(7):871-9. doi: 10.1111/cas.12159. Epub 2013 May 2. 10.1111/cas.12159 PubMed 23551833