pAAV-EF1a-NES-tdTomato-LINuS-WPRE
(Plasmid
#159894)
-
PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 5335
- Total vector size (bp) 7318
-
Modifications to backboneCMV promoter→EF1α promoter beta-globin intron→WPRE
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-tdTomato-LINuS
-
SpeciesSynthetic
-
Insert Size (bp)1983
- Promoter EF1α promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLINuS is originally developed by Niopek et al. We synthesized the biLINuS10 sequence based on the paper (Niopek, 2014).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Niopek et al Nat Commun. 2014 Jul 14;5:4404. doi: 10.1038/ncomms5404.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-NES-tdTomato-LINuS-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 159894 ; http://n2t.net/addgene:159894 ; RRID:Addgene_159894) -
For your References section:
Visualization of a blue light transmission area in living animals using light-induced nuclear translocation of fluorescent proteins. Inutsuka A, Kimizuka N, Takanohashi N, Yakabu H, Onaka T. Biochem Biophys Res Commun. 2020 Jan 29;522(1):138-143. doi: 10.1016/j.bbrc.2019.11.023. Epub 2019 Nov 19. 10.1016/j.bbrc.2019.11.023 PubMed 31757418