Skip to main content

pAAV-EF1a-NES-tdTomato-LINuS-WPRE
(Plasmid #159894)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159894 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 5335
  • Total vector size (bp) 7318
  • Modifications to backbone
    CMV promoter→EF1α promoter beta-globin intron→WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-tdTomato-LINuS
  • Species
    Synthetic
  • Insert Size (bp)
    1983
  • Promoter EF1α promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    LINuS is originally developed by Niopek et al. We synthesized the biLINuS10 sequence based on the paper (Niopek, 2014).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Niopek et al Nat Commun. 2014 Jul 14;5:4404. doi: 10.1038/ncomms5404.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-NES-tdTomato-LINuS-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 159894 ; http://n2t.net/addgene:159894 ; RRID:Addgene_159894)
  • For your References section:

    Visualization of a blue light transmission area in living animals using light-induced nuclear translocation of fluorescent proteins. Inutsuka A, Kimizuka N, Takanohashi N, Yakabu H, Onaka T. Biochem Biophys Res Commun. 2020 Jan 29;522(1):138-143. doi: 10.1016/j.bbrc.2019.11.023. Epub 2019 Nov 19. 10.1016/j.bbrc.2019.11.023 PubMed 31757418