Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-EF1a-NES-tdTomato-LINuS-WPRE
(Plasmid #159894)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 5335
  • Total vector size (bp) 7318
  • Modifications to backbone
    CMV promoter→EF1α promoter beta-globin intron→WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-tdTomato-LINuS
  • Species
    Synthetic
  • Insert Size (bp)
    1983
  • Promoter EF1α promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Niopek et al Nat Commun. 2014 Jul 14;5:4404. doi: 10.1038/ncomms5404.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-NES-tdTomato-LINuS-WPRE was a gift from Tatsushi Onaka (Addgene plasmid # 159894 ; http://n2t.net/addgene:159894 ; RRID:Addgene_159894)
  • For your References section:

    Visualization of a blue light transmission area in living animals using light-induced nuclear translocation of fluorescent proteins. Inutsuka A, Kimizuka N, Takanohashi N, Yakabu H, Onaka T. Biochem Biophys Res Commun. 2020 Jan 29;522(1):138-143. doi: 10.1016/j.bbrc.2019.11.023. Epub 2019 Nov 19. 10.1016/j.bbrc.2019.11.023 PubMed 31757418