NbPT5b-p3
(Plasmid #160001)

• Purpose: Multigene construct containing the betalain pigment biosynthetic genes under the control of the NbPT5b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana roots.
• Depositing Lab: Sam Brockington
• Publication: Timoneda et al PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326.

Backbone

• Vector backbone: pICSL4723
• Backbone manufacturer: 86173 (Mark Youles)
• Backbone size w/o insert (bp): 4901
• Total vector size (bp): 14129
• Vector type: Plant Expression
• Selectable markers: Bar

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Bar (reverse orientation)
• Alt name: Phosphinotricin N-acetyltransferase
• Alt name: Bialaphos resistance
• Insert Size (bp): 552
• GenBank ID:
• Promoter: Agrobacterium tumefaciens Nopaline synthase Promoter (AtuNos Pro)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: Bar_F: ATGTCTCCTGAAAGAAGGCC
• 3′ sequencing primer: Bar_R: TCAAATCTCAGTCACAGGAAGA

Gene/Insert 2

• Gene/Insert name: DODAα1
• Alt name: 4,5-DOPA dioxygenase alpha 1
• Species: Beta vulgaris
• Insert Size (bp): 828
• GenBank ID: MH836616
• Promoter: Nicotiana benthamiana Phosphate transporter 5b (NbPT5b Pro)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: BvDODAα1_F: ATGAAAATGATGAATGGAGAAG
• 3′ sequencing primer: BvDODAα1_R: CTAGGCTGAAGTGAACTTGTAG

Gene/Insert 3

• Gene/Insert name: CYP76AD1
• Alt name: cytochrome P450 76AD1
• Species: Beta vulgaris
• Insert Size (bp): 1494
• GenBank ID: MH836617
• Promoter: Nicotiana benthamiana Phosphate transporter 5b (NbPT5b Pro)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: BvCYP76AD1_F: ATGGATCATGCAACATTAGCA
• 3′ sequencing primer: BvCYP76AD1_R: TCAATACCTAGGTATTGGAATAAGTTTTAA

Gene/Insert 4

• Gene/Insert name: cDOPA5GT
• Alt name: cyclo-DOPA 5-O-glucosyltransferase
• Species: Mirabilis jalapa
• Insert Size (bp): 1503
• GenBank ID: MH836618
• Promoter: Nicotiana benthamiana Phosphate transporter 5b (NbPT5b Pro)

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: MjcDOPA5GT_F: ATGACCGCCATTAAAATG
• 3′ sequencing primer: MjcDOPA5GT_R: TTATTGAAGAGAAGGTTCCAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry