MtPT4-p3
(Plasmid
#160003)
-
PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICSL4723
-
Backbone manufacturer86173 (Mark Youles)
- Backbone size w/o insert (bp) 4901
- Total vector size (bp) 14730
-
Vector typePlant Expression
-
Selectable markersDSRed
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDsRed (reverse orientation)
-
Insert Size (bp)678
- Promoter Arabidopsis thaliana Ubiquitin 10 Promoter (AtUb10 Pro)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer DsRed_F: ATGGGGTCATCCAAGAATGTTATC
- 3′ sequencing primer DsRed_R: TTAAAGGAACAGATGGTGGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDODAα1
-
Alt name4,5-DOPA dioxygenase alpha 1
-
SpeciesBeta vulgaris
-
Insert Size (bp)828
-
GenBank IDMH836616
- Promoter Medicago truncatula Phosphate Transporter 4 Promoter (MtPT4 Pro)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer BvDODAα1_F: ATGAAAATGATGAATGGAGAAG
- 3′ sequencing primer BvDODAα1_R: CTAGGCTGAAGTGAACTTGTAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCYP76AD1
-
Alt namecytochrome P450 76AD1
-
SpeciesBeta vulgaris
-
Insert Size (bp)1494
-
GenBank IDMH836617
- Promoter Medicago truncatula Phosphate Transporter 4 Promoter (MtPT4 Pro)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer BvCYP76AD1_F: ATGGATCATGCAACATTAGCA
- 3′ sequencing primer BvCYP76AD1_R: TCAATACCTAGGTATTGGAATAAGTTTTAA (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namecDOPA5GT
-
Alt namecyclo-DOPA 5-O-glucosyltransferase
-
SpeciesMirabilis jalapa
-
Insert Size (bp)1503
-
GenBank IDMH836618
- Promoter Medicago truncatula Phosphate Transporter 4 Promoter (MtPT4 Pro)
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer MjcDOPA5GT_F: ATGACCGCCATTAAAATG
- 3′ sequencing primer MjcDOPA5GT_R: TTATTGAAGAGAAGGTTCCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MtPT4-p3 was a gift from Sam Brockington (Addgene plasmid # 160003 ; http://n2t.net/addgene:160003 ; RRID:Addgene_160003) -
For your References section:
MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583