Skip to main content

CBSH3- shRNA1
(Plasmid #160208)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160208 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mu6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARHGEF9
  • Alt name
    Collybistin
  • gRNA/shRNA sequence
    GATCGGGAATGCTCTGGGTGAACC
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Entrez Gene
    Arhgef9
  • Promoter mouse U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site Xba (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CBSH3- shRNA1 specifically targets collybistin MQW-CBSH3 isoforms, which are the main CBSH3- isoforms in rat. Target is located in the protein coding region. Nucleotides 402-425 of AJ302676 [CB2SH3-]. Targets MQW collybistin isoforms without SH3 domain. CBSH3- shRNA1 would also target the human MQW-CBSH3- isoforms. There is also a control mutated shRNA for this isoform (Addgene plasmid #160209).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CBSH3- shRNA1 was a gift from Angel de Blas (Addgene plasmid # 160208 ; http://n2t.net/addgene:160208 ; RRID:Addgene_160208)
  • For your References section:

    Collybistin SH3-protein isoforms are expressed in the rat brain promoting gephyrin and GABA-A receptor clustering at GABAergic synapses. George S, Bear J Jr, Taylor MJ, Kanamalla K, Fekete CD, Chiou TT, Miralles CP, Papadopoulos T, De Blas AL. J Neurochem. 2021 May;157(4):1032-1051. doi: 10.1111/jnc.15270. Epub 2021 Jan 5. 10.1111/jnc.15270 PubMed 33316079