Skip to main content

pGEM-T Easy-AtpU6-29
(Plasmid #160219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEMT -Easy
  • Backbone manufacturer
    PROMEGA
  • Backbone size w/o insert (bp) 3015
  • Total vector size (bp) 3325
  • Vector type
    Golden Gate level 0 piece to express gRNAs

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pAtU6-29 promoter
  • Insert Size (bp)
    310

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ATGGCGGCCGCGGGAATTCGAT
  • 3′ sequencing primer GGCCGCGAATTCACTAGTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-T Easy-AtpU6-29 was a gift from Matias Kirst (Addgene plasmid # 160219 ; http://n2t.net/addgene:160219 ; RRID:Addgene_160219)
  • For your References section:

    Simple, efficient and open-source CRISPR/Cas9 strategy for multi-site genome editing in Populus tremula x alba. Triozzi P, Schmidt HW, Dervinis C, Kirst M, Conde D. Tree Physiol. 2021 May 7. pii: 6270869. doi: 10.1093/treephys/tpab066. 10.1093/treephys/tpab066 PubMed 33960379