ePB-PURO-FLAG-METTL3
(Plasmid
#160252)
-
PurposeFor stable integration of FLAG-METTL3 in human cells with trasposase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneePB-PURO
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 8700
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemethyltransferase like 3
-
Alt nameMETTL3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1767
-
GenBank IDNM_019852.5
-
Entrez GeneMETTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)
- Promoter tight TRE promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCCAAGCTTATGTCGGACACGTGGAGC
- 3′ sequencing primer ATTTGCGGCCGCCTATAAATTCTTAGGTTTAGAGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ePB-PURO-FLAG-METTL3 was a gift from Alessandro Fatica (Addgene plasmid # 160252 ; http://n2t.net/addgene:160252 ; RRID:Addgene_160252) -
For your References section:
METTL3 regulates WTAP protein homeostasis. Sorci M, Ianniello Z, Cruciani S, Larivera S, Ginistrelli LC, Capuano E, Marchioni M, Fazi F, Fatica A. Cell Death Dis. 2018 Jul 23;9(8):796. doi: 10.1038/s41419-018-0843-z. 10.1038/s41419-018-0843-z PubMed 30038300