pPICZ-aC-MSVU-BZ
(Plasmid
#160426)
-
PurposeExpression of c-luciferase from sp. Maristella sp. SVU (Belize)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPICZ-alphaC
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 3600
- Total vector size (bp) 5200
-
Vector typeYeast Expression, Luciferase
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameluciferase
-
Alt nameLuciferin 2 mono-oxygenase
-
SpeciesMaristella sp. SVU
-
Insert Size (bp)1602
-
MutationSee depositor comments below
- Promoter AOX
-
Tags
/ Fusion Proteins
- Yeast alpha secretion factor (N terminal on backbone)
- c-myc epitope tag (C terminal on backbone)
- 6x Histidine tag (C terminal on backbone)
- stop codon (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TACTATTGCCAGCATTGCTGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a 39bp deletion that removes the N-terminal amino acids AQDCYEFTLEKRE from the luciferase compared to the depositor's insert sequence. It is not known how this discrepancy affects the plasmid function, though the plasmid was functional in the depositor's experiments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPICZ-aC-MSVU-BZ was a gift from Todd Oakley (Addgene plasmid # 160426 ; http://n2t.net/addgene:160426 ; RRID:Addgene_160426) -
For your References section:
Selection, drift, and constraint in cypridinid luciferases and the diversification of bioluminescent signals in sea fireflies. Hensley NM, Ellis EA, Leung NY, Coupart J, Mikhailovsky A, Taketa DA, Tessler M, Gruber DF, De Tomaso AW, Mitani Y, Rivers TJ, Gerrish GA, Torres E, Oakley TH. Mol Ecol. 2020 Oct 8. doi: 10.1111/mec.15673. 10.1111/mec.15673 PubMed 33031624