Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPICZ-aC-MSVU-BZ
(Plasmid #160426)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160426 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPICZ-alphaC
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 5200
  • Vector type
    Yeast Expression, Luciferase
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luciferase
  • Alt name
    Luciferin 2 mono-oxygenase
  • Species
    Maristella sp. SVU
  • Insert Size (bp)
    1602
  • Mutation
    See depositor comments below
  • Promoter AOX
  • Tags / Fusion Proteins
    • Yeast alpha secretion factor (N terminal on backbone)
    • c-myc epitope tag (C terminal on backbone)
    • 6x Histidine tag (C terminal on backbone)
    • stop codon (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TACTATTGCCAGCATTGCTGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 39bp deletion that removes the N-terminal amino acids AQDCYEFTLEKRE from the luciferase compared to the depositor's insert sequence. It is not known how this discrepancy affects the plasmid function, though the plasmid was functional in the depositor's experiments.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPICZ-aC-MSVU-BZ was a gift from Todd Oakley (Addgene plasmid # 160426 ; http://n2t.net/addgene:160426 ; RRID:Addgene_160426)
  • For your References section:

    Selection, drift, and constraint in cypridinid luciferases and the diversification of bioluminescent signals in sea fireflies. Hensley NM, Ellis EA, Leung NY, Coupart J, Mikhailovsky A, Taketa DA, Tessler M, Gruber DF, De Tomaso AW, Mitani Y, Rivers TJ, Gerrish GA, Torres E, Oakley TH. Mol Ecol. 2020 Oct 8. doi: 10.1111/mec.15673. 10.1111/mec.15673 PubMed 33031624