Skip to main content

pPICZ-aC-KHC-BZ
(Plasmid #160427)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160427 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPICZ-alphaC
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 5200
  • Vector type
    Yeast Expression, Luciferase
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luciferase
  • Alt name
    Luciferin 2 mono-oxygenase
  • Species
    Kornickeria hastingsi carriebowae
  • Insert Size (bp)
    1605
  • Promoter AOX
  • Tags / Fusion Proteins
    • Yeast alpha secretion factor (N terminal on backbone)
    • c-myc epitope tag (C terminal on backbone)
    • 6x Histidine tag (C terminal on backbone)
    • stop codon (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TACTATTGCCAGCATTGCTGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPICZ-aC-KHC-BZ was a gift from Todd Oakley (Addgene plasmid # 160427 ; http://n2t.net/addgene:160427 ; RRID:Addgene_160427)
  • For your References section:

    Selection, drift, and constraint in cypridinid luciferases and the diversification of bioluminescent signals in sea fireflies. Hensley NM, Ellis EA, Leung NY, Coupart J, Mikhailovsky A, Taketa DA, Tessler M, Gruber DF, De Tomaso AW, Mitani Y, Rivers TJ, Gerrish GA, Torres E, Oakley TH. Mol Ecol. 2020 Oct 8. doi: 10.1111/mec.15673. 10.1111/mec.15673 PubMed 33031624