pMJB1-RPL1B-Cl
(Plasmid
#160430)
-
PurposeExpresses "cre-less" yeast RPL1B tagged with mCherry under the GAL1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMJB1
- Backbone size w/o insert (bp) 6401
- Total vector size (bp) 7052
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPL1B
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)651
-
MutationRemoved introns, shuffled codons to vary nucleotide sequence but maintain amino acid sequence
-
GenBank IDNC_001139.9
- Promoter S. cerevisiae GAL1
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTAACGTCAAGGAGAAGGTT
- 3′ sequencing primer TGATGATGGCCATGTTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.05.11.089300v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJB1-RPL1B-Cl was a gift from Gary Stormo (Addgene plasmid # 160430 ; http://n2t.net/addgene:160430 ; RRID:Addgene_160430) -
For your References section:
Autoregulation of yeast ribosomal proteins discovered by efficient search for feedback regulation. Roy B, Granas D, Bragg F Jr, Cher JAY, White MA, Stormo GD. Commun Biol. 2020 Dec 11;3(1):761. doi: 10.1038/s42003-020-01494-z. 10.1038/s42003-020-01494-z PubMed 33311538