Skip to main content
Addgene

AlkB-D135G
(Plasmid #160434)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160434 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a(+)
  • Backbone size w/o insert (bp) 5295
  • Total vector size (bp) 5913
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E. coli AlkB
  • Species
    Escherichia coli
  • Insert Size (bp)
    618
  • Mutation
    Changed Aspartic acid 135 to Glycine; deleted the first 11 amino acids
  • GenBank ID
    NC_000913.3
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AlkB-D135G was a gift from Tao Pan (Addgene plasmid # 160434 ; http://n2t.net/addgene:160434 ; RRID:Addgene_160434)
  • For your References section:

    A high-throughput screening method for evolving a demethylase enzyme with improved and new functionalities. Wang Y, Katanski CD, Watkins C, Pan JN, Dai Q, Jiang Z, Pan T. Nucleic Acids Res. 2021 Mar 18;49(5):e30. doi: 10.1093/nar/gkaa1213. 10.1093/nar/gkaa1213 PubMed 33337498