pDGB3_alpha1 P35S:SV40-AcrIIA4_CONb:Tnos (GB3344)
(Plasmid
#160635)
-
PurposeTU for SV40-AcrIIA4 protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and Tnos terminator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDGB3_alpha1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAcrIIA4
-
SpeciesSynthetic
-
Insert Size (bp)1810
-
MutationBsaI and BsmBI sites removed
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3_alpha1 P35S:SV40-AcrIIA4_CONb:Tnos (GB3344) was a gift from Diego Orzaez (Addgene plasmid # 160635 ; http://n2t.net/addgene:160635 ; RRID:Addgene_160635) -
For your References section:
Strong and tunable anti-CRISPR/Cas activities in plants. Calvache C, Vazquez-Vilar M, Selma S, Uranga M, Fernandez-Del-Carmen A, Daros JA, Orzaez D. Plant Biotechnol J. 2022 Feb;20(2):399-408. doi: 10.1111/pbi.13723. Epub 2021 Oct 31. 10.1111/pbi.13723 PubMed 34632687