-
PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101*
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameVchCAST proteins, crRNA, and donor DNA
-
SpeciesV. cholerae
- Promoter J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAGATCAGTTGGAAGAAT
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Previously referred to as INTEGRATE.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSL1521 (pSPIN, pSC101* backbone) was a gift from Samuel H. Sternberg (Addgene plasmid # 160729 ; http://n2t.net/addgene:160729 ; RRID:Addgene_160729) -
For your References section:
CRISPR RNA-guided integrases for high-efficiency, multiplexed bacterial genome engineering. Vo PLH, Ronda C, Klompe SE, Chen EE, Acree C, Wang HH, Sternberg SH. Nat Biotechnol. 2020 Nov 23. pii: 10.1038/s41587-020-00745-y. doi: 10.1038/s41587-020-00745-y. 10.1038/s41587-020-00745-y PubMed 33230293