Skip to main content

pSL1777 (pEffector)
(Plasmid #160731)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160731 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDFDuet-1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    VchCAST proteins and crRNA
  • Species
    V. cholerae
  • Promoter J23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCACCCTGAATTGACTCT
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Previously referred to as INTEGRATE.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSL1777 (pEffector) was a gift from Samuel H. Sternberg (Addgene plasmid # 160731 ; http://n2t.net/addgene:160731 ; RRID:Addgene_160731)
  • For your References section:

    CRISPR RNA-guided integrases for high-efficiency, multiplexed bacterial genome engineering. Vo PLH, Ronda C, Klompe SE, Chen EE, Acree C, Wang HH, Sternberg SH. Nat Biotechnol. 2020 Nov 23. pii: 10.1038/s41587-020-00745-y. doi: 10.1038/s41587-020-00745-y. 10.1038/s41587-020-00745-y PubMed 33230293