Skip to main content

pMXS-IRES-Blast POLD1
(Plasmid #160805)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160805 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXS-IRES-BLAST
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3324
  • Mutation
    Codon optimized C-terminal 230 amino acids
  • Entrez Gene
    POLD1 (a.k.a. CDC2, CRCS10, MDPL, POLD)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-Blast POLD1 was a gift from Richard Possemato (Addgene plasmid # 160805 ; http://n2t.net/addgene:160805 ; RRID:Addgene_160805)
  • For your References section:

    Hyperactive CDK2 Activity in Basal-like Breast Cancer Imposes a Genome Integrity Liability that Can Be Exploited by Targeting DNA Polymerase epsilon. Sviderskiy VO, Blumenberg L, Gorodetsky E, Karakousi TR, Hirsh N, Alvarez SW, Terzi EM, Kaparos E, Whiten GC, Ssebyala S, Tonzi P, Mir H, Neel BG, Huang TT, Adams S, Ruggles KV, Possemato R. Mol Cell. 2020 Oct 28. pii: S1097-2765(20)30723-1. doi: 10.1016/j.molcel.2020.10.016. 10.1016/j.molcel.2020.10.016 PubMed 33152268