Skip to main content

pLNL1130
(Plasmid #160861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160861 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A
  • Total vector size (bp) 4448
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    O-acyltransferase WSD
  • Alt name
    wax-dgaT
  • Species
    Acinetvobacter baylyi
  • Insert Size (bp)
    2218
  • Promoter PJ23110
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer accatctgaatcatgcgcgg
  • 3′ sequencing primer ctggttccggctgtcttgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNL1130 was a gift from John Dueber (Addgene plasmid # 160861 ; http://n2t.net/addgene:160861 ; RRID:Addgene_160861)
  • For your References section:

    Exploration of Acetylation as a Base-Labile Protecting Group in Escherichia coli for an Indigo Precursor. Latimer LN, Russ ZN, Lucas J, Dueber JE. ACS Synth Biol. 2020 Sep 18. doi: 10.1021/acssynbio.0c00297. 10.1021/acssynbio.0c00297 PubMed 32886882