pLNL1141
(Plasmid
#160867)
-
PurposePJ23110-RBS-PhCFAT-mRuby2-tL3S2P24_KanR_p15A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Total vector size (bp) 4436
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameConiferyl alcohol acyltransferase
-
Alt nameCFAT
-
SpeciesSynthetic; Petunia hybrida (Petunia)
-
Insert Size (bp)2206
- Promoter PJ23110
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer accatctgaatcatgcgcgg
- 3′ sequencing primer ctggttccggctgtcttgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNL1141 was a gift from John Dueber (Addgene plasmid # 160867 ; http://n2t.net/addgene:160867 ; RRID:Addgene_160867) -
For your References section:
Exploration of Acetylation as a Base-Labile Protecting Group in Escherichia coli for an Indigo Precursor. Latimer LN, Russ ZN, Lucas J, Dueber JE. ACS Synth Biol. 2020 Sep 18. doi: 10.1021/acssynbio.0c00297. 10.1021/acssynbio.0c00297 PubMed 32886882