-
PurposeCRISPR_Cas9, lambda red recombineering
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 11298
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesStreptococcus thermophilus
- Promoter araBAD
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site sbf1 (not destroyed)
- 3′ cloning site xba1 (not destroyed)
- 5′ sequencing primer -
- 3′ sequencing primer tctagattaagaaataatcttcatc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLambda Red Recombineering Genes
- Promoter araBAD
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site xba1 (not destroyed)
- 3′ cloning site xba1 (not destroyed)
- 5′ sequencing primer tctagattctactggtattggcaca
- 3′ sequencing primer tctagacatgagcggatacatattt
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameZeocin Resistance Cassette
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site eco0109i (not destroyed)
- 3′ cloning site eco0109i (not destroyed)
- 5′ sequencing primer agGGCCTATTATTAACGCTTACAAT
- 3′ sequencing primer aggccCTGTCTGACGCTCAGTGGAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid #62225: pCas
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
zeocin was cloned from the pCR2.1 topo gene from the invitrogen blunt topo plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19_CRISPR_DpmrA was a gift from Anne-Catrin Uhlemann (Addgene plasmid # 160903 ; http://n2t.net/addgene:160903 ; RRID:Addgene_160903) -
For your References section:
CrrB Positively Regulates High-Level Polymyxin Resistance and Virulence in Klebsiella pneumoniae. McConville TH, Annavajhala MK, Giddins MJ, Macesic N, Herrera CM, Rozenberg FD, Bhushan GL, Ahn D, Mancia F, Trent MS, Uhlemann AC. Cell Rep. 2020 Oct 27;33(4):108313. doi: 10.1016/j.celrep.2020.108313. 10.1016/j.celrep.2020.108313 PubMed 33113377