Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

A1ACR1_EYFP_pcDNA3.1
(Plasmid #161025)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 161025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A1ACR1
  • Species
    Aurantiochytrium sp.
  • Insert Size (bp)
    810
  • GenBank ID
    MT002468
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A1ACR1_EYFP_pcDNA3.1 was a gift from John Spudich (Addgene plasmid # 161025 ; http://n2t.net/addgene:161025 ; RRID:Addgene_161025)
  • For your References section:

    RubyACRs, nonalgal anion channelrhodopsins with highly red-shifted absorption. Govorunova EG, Sineshchekov OA, Li H, Wang Y, Brown LS, Spudich JL. Proc Natl Acad Sci U S A. 2020 Sep 15;117(37):22833-22840. doi: 10.1073/pnas.2005981117. Epub 2020 Sep 1. 10.1073/pnas.2005981117 PubMed 32873643