PgACR1_EYFP_pcDNA3.1
(Plasmid
#161028)
-
PurposeExpresses PgACR1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePgACR1
-
SpeciesPhaeocystis globosa
-
Insert Size (bp)900
-
GenBank IDMT002472
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PgACR1_EYFP_pcDNA3.1 was a gift from John Spudich (Addgene plasmid # 161028 ; http://n2t.net/addgene:161028 ; RRID:Addgene_161028) -
For your References section:
RubyACRs, nonalgal anion channelrhodopsins with highly red-shifted absorption. Govorunova EG, Sineshchekov OA, Li H, Wang Y, Brown LS, Spudich JL. Proc Natl Acad Sci U S A. 2020 Sep 15;117(37):22833-22840. doi: 10.1073/pnas.2005981117. Epub 2020 Sep 1. 10.1073/pnas.2005981117 PubMed 32873643