THI ONLY pGAP T3
(Plasmid
#161506)
-
PurposeNon activation control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_only_SV40NLS_pGAP_THI11_T3_gRNA_MS2
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene#98552 BB3rN_AD
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 10676
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Nourseothricin (clonNat), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCAS9
- Promoter pTEF2
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gaggtatgtaggcggtgcta
- 3′ sequencing primer GTACTGTGTCGTGAAGGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMS2 (non activation control NAC)
- Promoter pPOR1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCCTTCACGACACAGTAC
- 3′ sequencing primer GACAGTGGAGGAAAATAATGTGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namegRNA (Targeting T3 in the THI11 promoter)
- Promoter pGAP
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer GCACATTATTTTCCTCCACTGTC
- 3′ sequencing primer ttatatttctctacaggggc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
THI ONLY pGAP T3 was a gift from Brigitte Gasser & Diethard Mattanovich (Addgene plasmid # 161506 ; http://n2t.net/addgene:161506 ; RRID:Addgene_161506) -
For your References section:
Fine-Tuning of Transcription in Pichia pastoris Using dCas9 and RNA Scaffolds. Baumschabl M, Prielhofer R, Mattanovich D, Steiger MG. ACS Synth Biol. 2020 Dec 18;9(12):3202-3209. doi: 10.1021/acssynbio.0c00214. Epub 2020 Nov 12. 10.1021/acssynbio.0c00214 PubMed 33180466