pMOD_B-Pho2-1/2-2-tRNA
(Plasmid
#161761)
-
PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMOD_B2303
-
Backbone manufacturerVoytas Plant Genome Engineering Tool kit
- Backbone size w/o insert (bp) 1990
- Total vector size (bp) 3828
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs
-
gRNA/shRNA sequenceMsPho2-1 and MsPho2-2
-
Speciesalflafa
- Promoter CmYLCV Promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTAGAAGTAGTCAAGGCGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD_B-Pho2-1/2-2-tRNA was a gift from Shaun Curtin (Addgene plasmid # 161761 ; http://n2t.net/addgene:161761 ; RRID:Addgene_161761) -
For your References section:
Alfalfa (Medicago sativa L.) pho2 mutant plants hyperaccumulate phosphate. Miller SS, Dornbusch MR, Farmer AD, Huertas R, Gutierrez-Gonzalez JJ, Young ND, Samac DA, Curtin SJ. G3 (Bethesda). 2022 May 30;12(6). pii: 6574359. doi: 10.1093/g3journal/jkac096. 10.1093/g3journal/jkac096 PubMed 35471600