Skip to main content

lentiCRISPR v2-sgSmg7
(Plasmid #161809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161809 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Zhang lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting mouse Smg7
  • Alt name
    Smg7
  • gRNA/shRNA sequence
    TACTCAGGTATACATGACCG
  • Species
    M. musculus (mouse), Synthetic
  • GenBank ID
  • Entrez Gene
    Smg7 (a.k.a. 9430023P16Rik, mKIAA0250)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgSmg7 was a gift from Yi Zhang (Addgene plasmid # 161809 ; http://n2t.net/addgene:161809 ; RRID:Addgene_161809)
  • For your References section:

    A transcriptional roadmap for 2C-like-to-pluripotent state transition. Fu X, Djekidel MN, Zhang Y. Sci Adv. 2020 May 29;6(22):eaay5181. doi: 10.1126/sciadv.aay5181. eCollection 2020 May. 10.1126/sciadv.aay5181 PubMed 32523982