Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLV.PGK.hLHX6
(Plasmid #161828)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 161828 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7026
  • Total vector size (bp) 8205
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human LHX6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1179
  • Mutation
    AA 17-23 deletion
  • GenBank ID
    NM_014368.5
  • Entrez Gene
    LHX6 (a.k.a. LHX6.1)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggacagcgccagggagcaat
  • 3′ sequencing primer catagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that the Addgene full sequence differs from the depositor's sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.PGK.hLHX6 was a gift from Daniella Ottosson (Addgene plasmid # 161828 ; http://n2t.net/addgene:161828 ; RRID:Addgene_161828)
  • For your References section:

    Direct Conversion of Human Stem Cell-Derived Glial Progenitor Cells into GABAergic Interneurons. Giacomoni J, Bruzelius A, Stamouli CA, Rylander Ottosson D. Cells. 2020 Nov 10;9(11). pii: cells9112451. doi: 10.3390/cells9112451. 10.3390/cells9112451 PubMed 33182669