pLV.PGK.hLHX6
(Plasmid
#161828)
-
PurposeExpresses human LHX6(LIM Homeobox 6) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7026
- Total vector size (bp) 8205
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman LHX6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
MutationAA 17-23 deletion
-
GenBank IDNM_014368.5
-
Entrez GeneLHX6 (a.k.a. LHX6.1)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ggacagcgccagggagcaat
- 3′ sequencing primer catagttaagaataccag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene full sequence differs from the depositor's sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.PGK.hLHX6 was a gift from Daniella Ottosson (Addgene plasmid # 161828 ; http://n2t.net/addgene:161828 ; RRID:Addgene_161828) -
For your References section:
Direct Conversion of Human Stem Cell-Derived Glial Progenitor Cells into GABAergic Interneurons. Giacomoni J, Bruzelius A, Stamouli CA, Rylander Ottosson D. Cells. 2020 Nov 10;9(11). pii: cells9112451. doi: 10.3390/cells9112451. 10.3390/cells9112451 PubMed 33182669