IBMc071
(Plasmid
#161943)
-
PurposeContains Type IIS restriction site free elements for expressing protein to be split in IBM. ECF20 expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB3T5(BsaI-)
-
Backbone manufacturerBaojun Wang's Lab
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20-T
-
SpeciesSynthetic
- Promoter PBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IBMc071 was a gift from Baojun Wang (Addgene plasmid # 161943 ; http://n2t.net/addgene:161943 ; RRID:Addgene_161943) -
For your References section:
A systematic approach to inserting split inteins for Boolean logic gate engineering and basal activity reduction. Ho TYH, Shao A, Lu Z, Savilahti H, Menolascina F, Wang L, Dalchau N, Wang B. Nat Commun. 2021 Apr 13;12(1):2200. doi: 10.1038/s41467-021-22404-9. 10.1038/s41467-021-22404-9 PubMed 33850130