-
Purpose3rd generation lentivirus transfer vector for Cre-removable Cas9, GFP reporter, and hygro resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX311
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 8504
- Total vector size (bp) 13772
-
Modifications to backbonesv40-blasticidin cassette replaced with sv40-eGFP; insertion of Cas9-2a-hygroR in EF1a Gateway cassette, insertion of loxP site in 3' LTR
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9-2a-hygromycin B phosphotransferase
-
SpeciesM. musculus (mouse), Synthetic; S. pyogenes Cas9
-
Mutationcodon-optimized for expression in M. musculus
- Promoter EF1a
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer EF-1a Forward (TCAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
- Promoter sv40
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
- 3′ sequencing primer EGFP-N (CGTCGCCGTCCAGCTCGACCAG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCAR_Cas9-hygro_GFP was a gift from Robert Manguso (Addgene plasmid # 162075 ; http://n2t.net/addgene:162075 ; RRID:Addgene_162075) -
For your References section:
In vivo screens using a selective CRISPR antigen removal lentiviral vector system reveal immune dependencies in renal cell carcinoma. Dubrot J, Lane-Reticker SK, Kessler EA, Ayer A, Mishra G, Wolfe CH, Zimmer MD, Du PP, Mahapatra A, Ockerman KM, Davis TGR, Kohnle IC, Pope HW, Allen PM, Olander KE, Iracheta-Vellve A, Doench JG, Haining WN, Yates KB, Manguso RT. Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001. 10.1016/j.immuni.2021.01.001 PubMed 33497609