pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-AU1
(Plasmid
#162111)
-
PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
-
Backbone manufacturerVectorbuilder
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePuromycin resistant; mCherry linked to StrepTagII-ProtC-AU1
-
Alt namemC-3-SPA
-
SpeciesSynthetic
-
MutationWT
- Promoter EF1A
-
Tag
/ Fusion Protein
- StrepTagII-ProtC-AU1 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 3′ sequencing primer aaaggagctgacaggtggtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
#13 out of 20 mCherry tagged combinations . Please visit https://doi.org/10.1101/2021.06.29.449991 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-AU1 was a gift from Julien Sage (Addgene plasmid # 162111 ; http://n2t.net/addgene:162111 ; RRID:Addgene_162111) -
For your References section:
Spatial epitope barcoding reveals clonal tumor patch behaviors. Rovira-Clave X, Drainas AP, Jiang S, Bai Y, Baron M, Zhu B, Dallas AE, Lee MC, Chu TP, Holzem A, Ayyagari R, Bhattacharya D, McCaffrey EF, Greenwald NF, Markovic M, Coles GL, Angelo M, Bassik MC, Sage J, Nolan GP. Cancer Cell. 2022 Nov 14;40(11):1423-1439.e11. doi: 10.1016/j.ccell.2022.09.014. Epub 2022 Oct 13. 10.1016/j.ccell.2022.09.014 PubMed 36240778