Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

LentiCRISPR v2-sgAMPK alpha1 clone2
(Plasmid #162120)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162120 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgAMPK alpha1
  • gRNA/shRNA sequence
    CGGCACCTTCGGCAAAGTGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR v2-sgAMPK alpha1 clone2 was a gift from Boyi Gan (Addgene plasmid # 162120 ; http://n2t.net/addgene:162120 ; RRID:Addgene_162120)
  • For your References section:

    Energy-stress-mediated AMPK activation inhibits ferroptosis. Lee H, Zandkarimi F, Zhang Y, Meena JK, Kim J, Zhuang L, Tyagi S, Ma L, Westbrook TF, Steinberg GR, Nakada D, Stockwell BR, Gan B. Nat Cell Biol. 2020 Feb;22(2):225-234. doi: 10.1038/s41556-020-0461-8. Epub 2020 Feb 6. 10.1038/s41556-020-0461-8 PubMed 32029897