Skip to main content

LentiCRISPR v2-sgAMPK alpha2 clone3
(Plasmid #162124)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162124 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgAMPK alpha2
  • gRNA/shRNA sequence
    ACTTACAGTTTGATAATATG
  • Species
    H. sapiens (human)
  • Entrez Gene
    PRKAA2 (a.k.a. AMPK, AMPK2, AMPKa2, PRKAA)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR v2-sgAMPK alpha2 clone3 was a gift from Boyi Gan (Addgene plasmid # 162124 ; http://n2t.net/addgene:162124 ; RRID:Addgene_162124)
  • For your References section:

    Energy-stress-mediated AMPK activation inhibits ferroptosis. Lee H, Zandkarimi F, Zhang Y, Meena JK, Kim J, Zhuang L, Tyagi S, Ma L, Westbrook TF, Steinberg GR, Nakada D, Stockwell BR, Gan B. Nat Cell Biol. 2020 Feb;22(2):225-234. doi: 10.1038/s41556-020-0461-8. Epub 2020 Feb 6. 10.1038/s41556-020-0461-8 PubMed 32029897