LentiCRISPR v2-sgLKB1 clone2
(Plasmid
#162126)
-
PurposeLentiviral sgRNA plasmid targeting human LKB1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgLKB1
-
gRNA/shRNA sequenceCACGGAGGGCGAGCTGATGT
-
SpeciesH. sapiens (human)
-
Entrez GeneSTK11 (a.k.a. LKB1, PJS, hLKB1)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR v2-sgLKB1 clone2 was a gift from Boyi Gan (Addgene plasmid # 162126 ; http://n2t.net/addgene:162126 ; RRID:Addgene_162126) -
For your References section:
Energy-stress-mediated AMPK activation inhibits ferroptosis. Lee H, Zandkarimi F, Zhang Y, Meena JK, Kim J, Zhuang L, Tyagi S, Ma L, Westbrook TF, Steinberg GR, Nakada D, Stockwell BR, Gan B. Nat Cell Biol. 2020 Feb;22(2):225-234. doi: 10.1038/s41556-020-0461-8. Epub 2020 Feb 6. 10.1038/s41556-020-0461-8 PubMed 32029897