Skip to main content

CXCR4-SZ146a QTY
(Plasmid #162443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162443 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET20b
  • Modifications to backbone
    N/A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C-X-C chemokine receptor type 4
  • Alt name
    CD184
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    438
  • Mutation
    All L, I, V, F in the transmembrane region mutated to Q, T and Y, truncation from aa52 to aa245
  • GenBank ID
    NM_003467.3
  • Entrez Gene
    CXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
  • Tag / Fusion Protein
    • his-tag, Rho-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer aagcccgaaaggaagctgagtt
  • 3′ sequencing primer aactcagcttcctttcgggctt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CXCR4-SZ146a QTY was a gift from Shuguang Zhang (Addgene plasmid # 162443 ; http://n2t.net/addgene:162443 ; RRID:Addgene_162443)
  • For your References section:

    Non-full-length Water-Soluble CXCR4(QTY) and CCR5(QTY) Chemokine Receptors: Implication for Overlooked Truncated but Functional Membrane Receptors. Qing R, Tao F, Chatterjee P, Yang G, Han Q, Chung H, Ni J, Suter BP, Kubicek J, Maertens B, Schubert T, Blackburn C, Zhang S. iScience. 2020 Oct 28;23(12):101670. doi: 10.1016/j.isci.2020.101670. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101670 PubMed 33376963